Skip to main content

CRISPR Guide RNA Designer (API)

Find all PAM sites in a target sequence in order to design and score gRNAs for CRISPR experiments.

A
Written by Andres Perez-Manriquez

Contents of this Article


You can use the TeselaGen Platform to design gRNA for your CRISPR experiments. We are currently exposing this tool through our API. If you need to integrate this tool into your workflows, please contact our customer support team.


CRISPR Tool from TeselaGen's API Client

You can use our CRISPR tool using the utilities in our Python API client. You can follow the notebook published here.


API Endpoint for CRISPR Tool

In order to use the CRISPR tool directly through our API, you can use this endpoint. The Guide RNA Designer Tool uses different algorithms to find all PAM sites in the target sequence in order to design and score gRNAs based on existing ML-based models. The information needed in the request body needs to be the following:

• data:

- sequence: this is the genome sequence. The whole genome sequence is needed for more accurate on/off target score predictions.

- targetStart: start position (indexed from 0) of the target sequence relative to the genome sequence.

- targetEnd: end position of the target sequence relative to the genome sequence.


• options:

- pamSite: PAM Site of your CRISPR Enzyme (default: SpyoCas9 with PAM Site: 'NGG'). Supported CRISPR Enzymes:

- SpyoCas9 ('NGG')

- SaurCas9 ('NNGRR')

- AsCas12a ('TTTV')

- minScore: minimum on-target score desired for the designed guide RNAs (default: 40).

- maxNumber: maximum number of guide RNAs expected as a response (default is unlimited).

Here's an example of a request body.

{ 
data: {
sequence: "AGTCAGTACGTACGTACGTA...",
targetStart: 0,
targetEnd: 20
},
options: {
pamSite: "NGG",
minScore: 0.60,
maxNumber: 50
}
}


Returns an array of the designed Guide RNAs as JSON objects with the following properties:

  • sequence (string): guide RNA sequence.

  • forward (boolean): guide RNA for the forward target sequence.

  • start (number): start position of the target sequence for the guide RNA.

  • end (number): end position of the target sequence for the guide RNA.

  • pam (string): PAM Site used for the designed Guide RNA.

  • onTargetScore (float as string [0.000-1.000]): The on-target predicted score.

  • offTargetScore (float as string [0.000-1.000]): The off-target predicted score.

Response Example

The following JSON shows an example of Guide RNAs found together with the on-target and off-target scores.

[
{
"sequence": "gttttccctttgatatgtaa",
"forward": true,
"start": 2002,
"end": 2021,
"pam": "cgg",
"onTargetScore": "0.63",
"offTargetScore": "0.900"
},
{
"sequence": "agccagtatgttctctagtg",
"forward": true,
"start": 2112,
"end": 2131,
"pam": "tgg",
"onTargetScore": "0.615",
"offTargetScore": "1.000"
},
{
"sequence": "caaaaattttgcctcaaaac",
"forward": true,
"start": 2199,
"end": 2218,
"pam": "tgg",
"onTargetScore": "0.612",
"offTargetScore": "1.000"
}
]
Did this answer your question?